Protection against Virulent Mycobacterium aviumInfection following DNA Vaccination with the 35-Kilodalton Antigen Is Accompanied by Induction of Gamma Interferon-Secreting CD4+ T Cells
Ela Martin, Arun T. Kamath, [...], and Warwick J. Britton
ABSTRACT
Mycobacterium avium is an opportunistic pathogen that primarily infects immunocompromised individuals, although the frequency of M. avium infection is also increasing in the immunocompetent population. The antigen repertoire of M. avium varies from that of Mycobacterium tuberculosis, with the immunodominant 35-kDa protein being present in M. avium and Mycobacterium leprae but not in members of the M. tuberculosis complex. Here we show that a DNA vector encoding this M. avium 35-kDa antigen (DNA-35) induces protective immunity against virulent M. avium infection, and this protective effect persists over 14 weeks of infection. In C57BL/6 mice, DNA vaccines expressing the 35-kDa protein as a cytoplasmic or secreted protein, both induced strong T-cell gamma interferon (IFN-γ) and humoral immune responses. Furthermore, the antibody response was to conformational determinants, confirming that the vector-encoded protein had adopted the native conformation. DNA-35 immunization resulted in an increased activated/memory CD4+ T-cell response, with an accumulation of CD4+ CD44hi CD45RBlo T cells and an increase in antigen-specific IFN-γ production. The protective effect of the DNA-35 vectors against M. avium infection was comparable to that of vaccination with Mycobacterium bovis BCG and significantly greater than that for previous treated infection with M. avium. These results illustrate the importance of the 35-kDa protein in the protective response to M. avium infection and indicate that DNA vaccination successfully promotes a sustained level of protection during chronic M. avium infection.
Mycobacteria are widespread in nature and remain an important cause of infection in humans worldwide. Most often mycobacterial disease is associated with Mycobacterium tuberculosis and Mycobacterium leprae, the causative agents of tuberculosis and leprosy, respectively. There is, however, an increasing incidence of opportunistic infections caused by atypical mycobacterial species such as Mycobacterium avium, particularly in human immunodeficiency virus-infected patients (26). Until recently, M. aviumcomplex (MAC) organisms were rarely reported to cause disease in individuals without predisposing lung disease or AIDS (5). Recent reports indicate that pulmonary MAC infections are becoming a more prevalent clinical problem in individuals without predisposing conditions (26), particularly in the older female population (6). Furthermore, studies have shown that non-AIDS-related pulmonary disease caused by MAC is as common as pulmonary tuberculosis in many areas of the United States (23).
M. avium is resistant to many antimycobacterial drugs, and the current treatment for M. avium infection requires multidrug therapy (MDT) with a combination of two to four agents (3). With the emergence of drug-resistant M. avium, alternative therapy is required in order to control infection (12). The vaccine Mycobacterium bovis Bacille Calmette-Guerin (BCG) reduces the incidence of M. avium infection in humans (27); however, BCG offers only moderate levels of protection in animal models (25). A more effective vaccine combined with MDT may contribute to the control of M. aviuminfections. One vaccine strategy is immunization with DNA plasmids encoding microbial genes. This approach has had successful application in respect to viral, bacterial, and protozoan infections in animal models (9, 15, 19, 32). Protection of mice against M. tuberculosis infection after DNA vaccination has been reported using the hsp65 (21, 29, 32), 85A (15), 85B (18), PstS-3 (31), and 38-kDa (39) antigens (Ags). The Ag repertoire of MAC includes some shared with the M. tuberculosis complex but also includes proteins not present in BCG. The 35-kDa protein, first identified in M. leprae (16, 38), has a homologue in M. avium with 95% amino acid identity but not in the M. tuberculosis complex (35). The 35-kDa protein is an immunodominant Ag in the human response to M. leprae (22, 30, 34) and is recognized during murine infection with M. avium (11, 35). Therefore, we have constructed DNA vectors expressing the 35-kDa protein with and without a eukaryotic leader sequence. Vaccination stimulated strong Ag-specific T-cell responses to 35-kDa protein from M. avium and antibody responses to conformational determinants of the antigen. These vaccines induced significant persistent protection against M. avium infection, which was of the same magnitude afforded by BCG vaccination.
MATERIALS AND METHODS
Bacteria.
The M. avium isolate used is a virulent strain of serotype 8 isolated from an AIDS patient and was kindly provided by C. Cheers (University of Melbourne, Victoria, Australia). It was grown in Middlebrook 7H9 broth with supplement (Difco Laboratories, Detroit, Mich.) and frozen in 1-ml ampoules at −70°C. Before use, the suspension was thawed at 37°C and sonicated for 10 s to disperse clumps. For manipulation of plasmids, Escherichia coliMC1061, grown in Luria-Bertani broth or agar (28) supplemented with ampicillin (100 μg/ml) as required, was used. For large-scale plasmid purification, the transformed bacteria were grown in Circlegrow broth (Bio 101, Vista, Calif.) supplemented with ampicillin.
Protein purification from recombinant Mycobacterium smegmatis and antibodies (Abs).
The recombinant M. avium 35-kDa protein (r35-kDa protein) was purified by monoclonal Ab (MAb) affinity chromatography as described previously (35). Murine anti-M. leprae 35-kDa protein MAbs CS-38 and ML03 were kind gifts of P. J. Brennan (Colorado State University, Fort Collins) and J. Ivanyi (Hammersmith Hospital, London, United Kingdom), respectively.
Production of DNA vaccines.
The vector, pJW4303, kindly provided by J. I. Mullins, University of Washington, Seattle, contains the cytomegalovirus early-immediate promoter with intron A upstream of the gene of interest and a bovine growth hormone polyadenylation sequence downstream. For prokaryotic manipulations, the selectable marker was the ampicillin resistance gene. The gene for the M. avium 35-kDa protein (for simplicity also referred to as 35 kDa) was amplified from plasmid pAJ9 (35). The 35-kDa-encoding gene was cloned into pJW4303 (DNA-Neg), using standard molecular biology techniques (28) and the 35-kDa-specific primers 5′ GCTAGAAGCTTATGACGTCGGCTC and 3′ CTACCGGACTCACTTGTACTCA to yield plasmid pJAM35 (DNA-35Cyt), containing the M. avium 35-kDa-encoding gene. The same gene was also cloned in frame with the tissue plasminogen activator (tPA) signal sequence of pJW4303, using the primers 5′ AATAGGCTAGCATGACGTCGGCTC and 3′ CTACCGGATCCTCACTTGTAC. This clone, pJAS35 (DNA-35Sec), permitted secretion of the mycobacterial protein from eukaryotic cells. The gene sequences were confirmed by double-stranded sequencing (Sequitherm; Epicentre Technologies, Madison, Wis.). DNA for immunization was purified by CsCl centrifugation, adjusted to 1 mg/ml in phosphate-buffered saline (PBS), and stored at −20°C until required.
COS cell transfection.
COS-7 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS) and 2 mM glutamate (complete DMEM). The cells were transfected using DEAE-dextran as described previously (4) with DNA-35Sec, DNA-35Cyt, or DNA-Neg. The cells were harvested and lysed, and the presence of the 35-kDa protein was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting with CS-38.
Immunization of animals.
C57BL/6 female mice were supplied as specific-pathogen-free mice by ARC (Perth, Australia) and were maintained in specific-pathogen-free conditions. Mice were immunized between 8 and 12 weeks of age with 50 μg of each plasmid by intramuscular injection into the tibialis anterior muscle of each hind leg. Control mice were immunized with PBS or DNA-Neg. Mice were immunized one to three times at biweekly intervals. For protein immunization, mice were injected subcutaneously at the base of the tail with 50 μg of the r35-kDa protein in incomplete Freund's adjuvant (IFA; Sigma, St. Louis, Mo.). Control groups received PBS in IFA.
Ab determination.
Mice were bled biweekly after the first immunization, and the presence of Ag-specific Abs was determined by enzyme-linked immunosorbent assay (ELISA) as previously described (34, 35), using recombinant mycobacterial proteins (at 10 μg/ml) and alkaline phosphatase-conjugated goat anti-murine immunoglobulin G (IgG; Sigma). To determine the titer of the Ag-specific antibody, the mean absorbance plus 3 standard deviations of normal mouse sera, at a dilution of 1:100, was adopted as the cutoff absorbance. For ELISAs carried out with denatured Ag, the 35-kDa protein was heated to 95°C for 10 min.
Lymphocyte proliferation and cytokine assays.
The inguinal, axillary, and para-aortic lymph nodes and the spleen were collected from immunized mice, and single-cell suspensions were prepared in complete RPMI medium supplemented with 2 mM glutamate, 50 μM β-mercaptoethanol, and 10% FCS. Lymphocyte proliferation and cytokine assays for gamma interferon (IFN-γ) were carried out as described previously (18). Briefly, IFN-γ was detected with MAbs R46A2 and biotinylated XMG 1.2 (Endogen, Woburn, Mass.) and a recombinant murine IFN-γ standard (5.08 × 106 U/mg; Genzyme, Cambridge, Mass.). The limit of detection was 0.4 U/ml (1 U is equivalent to 197 pg/ml).
Mycobacterial challenge.
Six weeks after the last boost with either DNA-35Cyt or DNA-35Sec, mice were infected by an intravenous (i.v.) challenge with 106 CFU of M. avium. Mice were sacrificed at 2, 4, 8, and 14 weeks after the infection, and bacteria in the spleen and liver homogenates were enumerated on Middlebrook 7H11 Bacto Agar. Mice were vaccinated with 5 × 104 CFU of BCG (CSL) i.v. or 105 CFU of M. avium (MAC primed) i.v. and 6 weeks later were treated with isoniazid (25 mg/kg) for 12 weeks. The presence of mycobacteria in organs was examined at the time of challenge and presented as mean CFU ± standard error of the mean (SEM).
Flow cytometry.
To identify leukocyte populations, cell surface molecules were labeled with Abs and analyzed by flow cytometry as described previously (7). The following MAbs were used for flow cytometry: anti-CD44-fluorescein isothiocyanate (FITC), anti-IFN-γ-FITC, anti-CD45RB-phycoerythrin (PE), anti-B220-PE, and anti-MAC1-FITC (Pharmingen, San Diego, Calif.). Anti-CD4-Tricolor, anti-CD8-Tricolour, and isotype control Abs were purchased from Caltag (San Francisco, Calif.).
Intracellular cytokine staining.
Cells were cultured at 37°C and 5% CO2 for 6 h in the presence of phorbol myristate acetate-iodomycin (PMA/Io; 50 ng/ml). Brefeldin A (10 μg/ml) was then added for a further 16 h. Cells were washed and stained with rat anti-mouse CD4 MAb (Caltag). Intracellular staining was carried out as described previously (8).
ELISPOT assay for cytokine-producing cells.
IFN-γ-secreting cells were quantified as described previously (18). Splenic mononuclear cells from immunized and M. avium-infected mice were purified by centrifugation on Histopaque-1083 (ρ = 1.083; Sigma). The cells were added to 96-well plates (4 × 105/well) and incubated with 35 kDa (10 μg/ml), M. avium sonicate (10 μg/ml), PMA/Io (50 ng/ml), or medium alone. The plates were incubated for 48 h at 37°C in an atmosphere of 5% CO2. The cells were then collected, washed, and counted, and the enzyme-linked spot (ELISPOT) assay was conducted as described previously, using MAb R46A2 (Endogen) for capture and XMG 1.2 (Endogen) for recognition of IFN-γ-secreting cells (18).
RESULTS
DNA vaccines expressed the 35-kDa protein.
To ensure that the plasmid DNA vaccine constructs were functional, we sequenced the plasmids and analyzed expression in vitro by transient transfection of COS-7 cells and Western blotting (Fig. (Fig.1).1). Transfection with DNA-35Cyt and DNA-35Sec resulted in similar levels of expression of the 35-kDa protein. Ag-specific Abs were detected 2 weeks after the first immunization of C57BL/6 mice with DNA-35 vectors (data not shown). Increasing titers of specific IgG were generated over the course of immunization with either DNA-35Cyt or DNA-35Sec, resulting in log10 titers of 4.43 ± 0.1 and 4.27 ± 0.15, respectively, at 6 weeks. To determine whether the antibody responses recognised conformational determinants on the 35-kDa antigen, ELISAs were conducted with denatured and nondenatured 35-kDa antigen and MAbs recognizing both linear and conformational determinants on the native 35-kDa protein. MAb CS-38, generated to the purified native 35-kDa protein (14), recognizes a linear determinant whereas MAb ML04 binds only the native 35-kDa protein in its nondenatured state (17). As shown in Table Table1,1, sera from DNA-35 immunized mice bound to the native protein but not to denatured 35-kDa antigen. ML04 also failed to bind to the denatured antigen, while MAb CS-38 reacted with both denatured and native protein.
No comments:
Post a Comment